stat 579

Midterm II - Sample

The three questions below give points adding up to 100 points (not counting extra credit). A passing grade will start at about 40 points, any score above 80 will receive an A.

Warm-up (15 points)

File brfss-2009-clean.csv contains the records from the BRFSS (Behavioral Risk Factor Surveillance System) as discussed in class earlier this semester.
  1. For each state, find the percentage of female and male population.
  2. The file fips-code.csv has a list of state names by FIPS code - used in the variable XSTATE in the BRFSS data. Use this data and the states data from the maps package to draw a map of the U.S. (mainland only) with states colored by percentage of male respondents.

Working with text (40 points + 2 + 5 points of extra credit)

  1. Write a function palindrome5(x) that is TRUE, if x is a palindrome of length 5 (i.e. x is five letters long and can be read from the back or the front, e.g. 'radar', 'level'). Extra points, if you can avoid an explicit loop or recursion.
  2. The file course-description.txt contains a description of all the courses offered by the Statistics Department at ISU. Read this file and convert to a data frame with columns 'Course', 'Name', 'Description'. Extra points, if you successfully extract number of credits from the description as well.
  3. For the following gene sequence:
    sequence <- 
    "ATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCACGGTCCCAATTGCTCGAGAGA
    TTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCATAACCTCCTATATTGACTGATCTGTAATAACCACGATATTA
    TTGGAATAAATAGGGGCTTGAAATTTGGAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTCT
    TTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGTTGCTATATTATATGTTTAGAG
    GTTGCTGCTTTGGTTATTGATAACGGTTCTGGTATGTGTAAAGCCGGTTTTGCCGGTGACGACGCTCCTCGTGCTGTCTT
    CCCATCTATCGTCGGTAGACCAAGACACCAAGGTATCATGGTCGGTATGGGTCAAAAAGACTCCTACGTTGGTGATGAAG
    CTCAATCCAAGAGAGGTATCTTGACTTTACGTTACCCAATTGAACACGGTATTGTCACCAACTGGGACGATATGGAAAAG
    ATCTGGCATCATACCTTCTACAACGAATTGAGAGTTGCCCCAGAAGAACACCCTGTTCTTTTGACTGAAGCTCCAATGAA
    CCCTAAATCAAACAGAGAAAAGATGACTCAAATTATGTTTGAAACTTTCAACGTTCCAGCCTTCTACGTTTCCATCCAAG
    CCGTTTTGTCCTTGTACTCTTCCGGTAGAACTACTGGTATTGTTTTGGATTCCGGTGATGGTGTTACTCACGTCGTTCCA
    ATTTACGCTGGTTTCTCTCTACCTCACGCCATTTTGAGAATCGATTTGGCCGGTAGAGATTTGACTGACTACTTGATGAA
    GATCTTGAGTGAACGTGGTTACTCTTTCTCCACCACTGCTGAAAGAGAAATTGTCCGTGACATCAAGGAAAAACTATGTT
    ACGTCGCCTTGGACTTCGAACAAGAAATGCAAACCGCTGCTCAATCTTCTTCAATTGAAAAATCCTACGAACTTCCAGAT
    GGTCAAGTCATCACTATTGGTAACGAAAGATTCAGAGCCCCAGAAGCTTTGTTCCATCCTTCTGTTTTGGGTTTGGAATC
    TGCCGGTATTGACCAAACTACTTACAACTCCATCATGAAGTGTGATGTCGATGTCCGTAAGGAATTATACGGTAACATCG
    TTATGTCCGGTGGTACCACCATGTTCCCAGGTATTGCCGAAAGAATGCAAAAGGAAATCACCGCTTTGGCTCCATCTTCC
    ATGAAGGTCAAGATCATTGCTCCTCCAGAAAGAAAGTACTCCGTCTGGATTGGTGGTTCTATCTTGGCTTCTTTGACTAC
    CTTCCAACAAATGTGGATCTCAAAACAAGAATACGACGAAAGTGGTCCATCTATCGTTCACCACAAGTGTTTCTAA"
    
    find all 3 letter 'words' (a word is a sequence of the letters 'A', 'G', 'C', and 'T') and the frequency of their occurence

Integration by simulation (45 points)

  1. Write a function integral (n, a,b,f) that estimates the area under function f between limits a and b using n uniform random numbers. The picture below shows a description of the process. In this example, 1000 pairs of random uniform values between [0.5,3.5] x [0,15] were used. 592 of them resulted in falling below the curve, giving an estimate for the are under curve as 0.592 * 3 * 15 = 26.64.
  2. Apply your function repeatedly (say, 20 times) to the curve f(x) = 2x(x-3)^2+5 between limits 1 and 4 using 2000 pairs of random numbers. Give an estimate for the area under the curve and a standard deviation.